typer 4.0 software mass array compact system Search Results


97
agena bioscience typer 4 0 software
Typer 4 0 Software, supplied by agena bioscience, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/MassARRAY+Typer+4%2E0/pmc09505012-45-0-4
Average 97 stars, based on 1 article reviews
typer 4 0 software - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

96
ATCC cercopithecus aethiops bsc 40 kidney epithelial cells female

Cercopithecus Aethiops Bsc 40 Kidney Epithelial Cells Female, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/BSC40/pmc11023057-100-0-8
Average 96 stars, based on 1 article reviews
cercopithecus aethiops bsc 40 kidney epithelial cells female - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
Kyfora Bio cell line human embryonic kidney 239t hek293t atcc crl 3216 rrid cvcl 0063 chemicals pei polysciences

Cell Line Human Embryonic Kidney 239t Hek293t Atcc Crl 3216 Rrid Cvcl 0063 Chemicals Pei Polysciences, supplied by Kyfora Bio, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/PEI+MAX+Transfection+Reagent/10__7554_slash_elife__55111-276-32-44
Average 99 stars, based on 1 article reviews
cell line human embryonic kidney 239t hek293t atcc crl 3216 rrid cvcl 0063 chemicals pei polysciences - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
ATCC human hek 293 passage 13 40

Human Hek 293 Passage 13 40, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/293%3B+Embryonic+Kidney%3B+Human/pmc11647142-95-0-6
Average 99 stars, based on 1 article reviews
human hek 293 passage 13 40 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

98
MedChemExpress doxorubicin
Genotoxic agents promote BCL6 expression. ( A ) Cell sensitivity to etoposide (ETO). Cancer cells were treated with etoposide at gradient concentrations for 48 h. IC 50 s were measured using Sulforhodamine B (SRB) assays. Values are expressed as mean ± SEM of three independent experiments. ETO-resistant cell lines are marked in red. Cell sensitivity to <t>doxorubicin</t> (ADR) was also examined (see ). ( B ) Heat map illustrating expression of BCL6 target genes in Capan-2, H661 and PC9 cell lines. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. mRNA was isolated from treated cells and sequenced. Z-scores were calculated based on counts of exon model per million mapped reads. BCL6 target genes were identified by a cutoff of P < 0.05, n = 3. ( C ) BCL6 mRNA expression in ETO-resistant and -sensitive cells. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. QPCR assays were subsequently performed. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ETO-resistant cell lines are marked in red. ( D ) Validation of differentially expressed target genes of BCL6 in Capan-2 and H661 cells using qPCR analysis. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ( E ) Normalized BCL6 mRNA expression levels in MCF7 and MCF7/ETO (required ETO-resistant MCF7), or A2780 and A2780/ADR (required ADR-resistant A2780). Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, *** P < 0.001, unpaired, two tailed t -test. ( F ) BCL6 protein expression levels in different cancer cell lines in response to various genotoxic agents. Cells were treated with indicated genotoxic agents for 24 h. BCL6 protein expression levels were detected and normalized to GAPDH expression using immunoblotting analysis. Representative images related to . The ratio of genotoxic agent-treated groups to the control group was calculated. CDDP, cisplatin; Carbo, carboplatin; GEM, gemcitabine. ( G ) Kaplan-Meier curves of ovarian cancer patients treated with cisplatin, taxol or both drugs. The curves were stratified by BCL6 (215990_s_at) expression. The following source data and figure supplements are available for : Figure 1-Source data 1. Genotoxic agents promote BCL6 expression. Figure 1-figure supplement 1. Genotoxic agents promote BCL6 expression.
Doxorubicin, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/Doxorubicin+hydrochloride/bio_rxiv__2021__06__15__448559-192-6-40
Average 98 stars, based on 1 article reviews
doxorubicin - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

92
Chondrex Inc scr1anttnf fc a mixture
Generation and characterization of <t>scR1antTNF-Fc</t> protein. A, schematic structure modeling of scR1antTNF-Fc protein. Two TNFR1 antagonistic proteins were fused with human IgG-Fc. N, N-terminal. Amino acid sequences and domain information of scR1antTNF-Fc are described in Fig. S1A. B, X-ray structure modeling of the scR1antTNF-TNFR1 complex. scR1antTNF bound to the homotrimer of TNFR1. Red, TNFR1; green, TNFR1 interaction domain of scR1antTNF; orange, peptide linker for forming the single-chain structure. C, schematic pCAG-based mammalian expression vector for scR1antTNF-Fc protein. The cDNA was composed to express scR1antTNF-Fc whereby triple R1antTNF domains fused by peptide linkers (GGGSGGG) were further fused to a human–IgG Fc domain (Ch2 and Ch3). Signal sequence peptide genes derived from a mouse IgG Vh (Vhss) or human IL-2 (IL-2ss) were linked at the 5′-terminal of scR1antTNF-Fc cDNA. D, supernatants of cultured medium (left side) and purified proteins (right side) 7 days after transfection were assessed by SDS-PAGE following Coomassie Brilliant Blue staining. Arrowhead shows an ∼75-kDa band of the scR1antTNF-Fc monomer. E, each recombinant protein expressed with Vhss and IL-2ss was purified by size-exclusion chromatography. F, the molecular weight of monomeric scR1antTNF-Fc protein was confirmed by Western blotting with an anti-human IgG-Fc antibody.
Scr1anttnf Fc A Mixture, supplied by Chondrex Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/Cell+Culture+Grade+Bovine+Type+I+Collagen/pmc07363114-513-6-16
Average 92 stars, based on 1 article reviews
scr1anttnf fc a mixture - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
ATCC human wil2 ns ecacc
Generation and characterization of <t>scR1antTNF-Fc</t> protein. A, schematic structure modeling of scR1antTNF-Fc protein. Two TNFR1 antagonistic proteins were fused with human IgG-Fc. N, N-terminal. Amino acid sequences and domain information of scR1antTNF-Fc are described in Fig. S1A. B, X-ray structure modeling of the scR1antTNF-TNFR1 complex. scR1antTNF bound to the homotrimer of TNFR1. Red, TNFR1; green, TNFR1 interaction domain of scR1antTNF; orange, peptide linker for forming the single-chain structure. C, schematic pCAG-based mammalian expression vector for scR1antTNF-Fc protein. The cDNA was composed to express scR1antTNF-Fc whereby triple R1antTNF domains fused by peptide linkers (GGGSGGG) were further fused to a human–IgG Fc domain (Ch2 and Ch3). Signal sequence peptide genes derived from a mouse IgG Vh (Vhss) or human IL-2 (IL-2ss) were linked at the 5′-terminal of scR1antTNF-Fc cDNA. D, supernatants of cultured medium (left side) and purified proteins (right side) 7 days after transfection were assessed by SDS-PAGE following Coomassie Brilliant Blue staining. Arrowhead shows an ∼75-kDa band of the scR1antTNF-Fc monomer. E, each recombinant protein expressed with Vhss and IL-2ss was purified by size-exclusion chromatography. F, the molecular weight of monomeric scR1antTNF-Fc protein was confirmed by Western blotting with an anti-human IgG-Fc antibody.
Human Wil2 Ns Ecacc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/WIL2-NS/pm31116985-319-43-55
Average 93 stars, based on 1 article reviews
human wil2 ns ecacc - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
Nikon nis elements ar 4 40 software
Generation and characterization of <t>scR1antTNF-Fc</t> protein. A, schematic structure modeling of scR1antTNF-Fc protein. Two TNFR1 antagonistic proteins were fused with human IgG-Fc. N, N-terminal. Amino acid sequences and domain information of scR1antTNF-Fc are described in Fig. S1A. B, X-ray structure modeling of the scR1antTNF-TNFR1 complex. scR1antTNF bound to the homotrimer of TNFR1. Red, TNFR1; green, TNFR1 interaction domain of scR1antTNF; orange, peptide linker for forming the single-chain structure. C, schematic pCAG-based mammalian expression vector for scR1antTNF-Fc protein. The cDNA was composed to express scR1antTNF-Fc whereby triple R1antTNF domains fused by peptide linkers (GGGSGGG) were further fused to a human–IgG Fc domain (Ch2 and Ch3). Signal sequence peptide genes derived from a mouse IgG Vh (Vhss) or human IL-2 (IL-2ss) were linked at the 5′-terminal of scR1antTNF-Fc cDNA. D, supernatants of cultured medium (left side) and purified proteins (right side) 7 days after transfection were assessed by SDS-PAGE following Coomassie Brilliant Blue staining. Arrowhead shows an ∼75-kDa band of the scR1antTNF-Fc monomer. E, each recombinant protein expressed with Vhss and IL-2ss was purified by size-exclusion chromatography. F, the molecular weight of monomeric scR1antTNF-Fc protein was confirmed by Western blotting with an anti-human IgG-Fc antibody.
Nis Elements Ar 4 40 Software, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/NIS-Elements/pmc09106360-288-9-14
Average 99 stars, based on 1 article reviews
nis elements ar 4 40 software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
ATCC sv 40 mes13
Effects of l -cysteine on methylglyoxal (MGO)-induced cell toxicity in <t>MES13</t> cells. ( A ) Chemical structure of ( a ); l -cysteine, ( b ); N -Acetyl- l -cysteine (NAC), ( c ); Cystine. ( B ) Cell viability of MES13 cells treated with MGO (500 μM) and equal concentrations (1.0 mM) of l -cysteine, NAC, and cystine. ( C ) Cell viability of MES13 cells treated with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( D ) Representative photographs of l -cysteine pre-treatment protection against MGO-induced cytotoxicity. Scale bar indicates 500 μm. ( E ) Quantitative measurements of confluence were evaluated using IncuCyte Zoom imaging system. ( F ) MGO-induced LDH production was evaluated by LDH assay in MES13 cells. All data are presented as mean ± SEM. n = 3 (### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).
Sv 40 Mes13, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/SV40+MES+13/pmc07016887-36-0-16
Average 95 stars, based on 1 article reviews
sv 40 mes13 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
ProMIS Neurosciences promis type software
Effects of l -cysteine on methylglyoxal (MGO)-induced cell toxicity in <t>MES13</t> cells. ( A ) Chemical structure of ( a ); l -cysteine, ( b ); N -Acetyl- l -cysteine (NAC), ( c ); Cystine. ( B ) Cell viability of MES13 cells treated with MGO (500 μM) and equal concentrations (1.0 mM) of l -cysteine, NAC, and cystine. ( C ) Cell viability of MES13 cells treated with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( D ) Representative photographs of l -cysteine pre-treatment protection against MGO-induced cytotoxicity. Scale bar indicates 500 μm. ( E ) Quantitative measurements of confluence were evaluated using IncuCyte Zoom imaging system. ( F ) MGO-induced LDH production was evaluated by LDH assay in MES13 cells. All data are presented as mean ± SEM. n = 3 (### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).
Promis Type Software, supplied by ProMIS Neurosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/promis+software/packard_noel__2023__exploiting_and_neutralising_the_communist_threat_for_the_privatised_internet-2097-4-4
Average 90 stars, based on 1 article reviews
promis type software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Chem Impex International cas
Effects of l -cysteine on methylglyoxal (MGO)-induced cell toxicity in <t>MES13</t> cells. ( A ) Chemical structure of ( a ); l -cysteine, ( b ); N -Acetyl- l -cysteine (NAC), ( c ); Cystine. ( B ) Cell viability of MES13 cells treated with MGO (500 μM) and equal concentrations (1.0 mM) of l -cysteine, NAC, and cystine. ( C ) Cell viability of MES13 cells treated with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( D ) Representative photographs of l -cysteine pre-treatment protection against MGO-induced cytotoxicity. Scale bar indicates 500 μm. ( E ) Quantitative measurements of confluence were evaluated using IncuCyte Zoom imaging system. ( F ) MGO-induced LDH production was evaluated by LDH assay in MES13 cells. All data are presented as mean ± SEM. n = 3 (### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).
Cas, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/Tween+20/pm33532735-31-124-159
Average 95 stars, based on 1 article reviews
cas - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
ATCC bxpc3 atcc crl
Figure 5. FAP localizes at invadopodia in various human cancer cells (A–C) (A) <t>BxPC3</t> and SCC61 cells were seeded onto gelatin-coated coverslips for 48 h and labeled for FAP (green), F-actin (red), and cortactin (blue). Confocal image of SCC61 (B) and BxPC3 (C). Traces 1 and 2 are z axis sectioning of invadopodia in each cell line; associated graphs represent pixel intensities along the dotted lines to show the colocalization of FAP, F-actin, and cortactin. Scale bar, 10 mm. See also Figure S4.
Bxpc3 Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/typer+4%2E0+software+mass+array+compact+system/BxPC-3/pm37862167-556-59-60
Average 99 stars, based on 1 article reviews
bxpc3 atcc crl - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


Journal: Cell reports

Article Title: Poxvirus A51R proteins regulate microtubule stability and antagonize a cell-intrinsic antiviral response

doi: 10.1016/j.celrep.2024.113882

Figure Lengend Snippet:

Article Snippet: Cercopithecus aethiops: BSC-40 kidney epithelial cells (female) , ATCC , CRL-2761.

Techniques: Virus, Control, Recombinant, Lysis, Staining, Protease Inhibitor, Magnetic Beads, Modification, Saline, Expressing, Transfection, Blocking Assay, Fractionation, HTS Assay, Plasmid Preparation, Software, Imaging

Journal: iScience

Article Title: Activity-dependent COX-2 proteolysis modulates aerobic respiration and proliferation in a prostaglandin-independent manner

doi: 10.1016/j.isci.2024.111403

Figure Lengend Snippet:

Article Snippet: Human HEK 293 passage 13-40 , ATCC , CRL-1573.

Techniques: Recombinant, Protease Inhibitor, Staining, Labeling, Membrane, In Vitro, Transfection, Electrophoresis, Sequencing, Modification, Enzyme-linked Immunosorbent Assay, Mutagenesis, Plasmid Preparation, Software

Genotoxic agents promote BCL6 expression. ( A ) Cell sensitivity to etoposide (ETO). Cancer cells were treated with etoposide at gradient concentrations for 48 h. IC 50 s were measured using Sulforhodamine B (SRB) assays. Values are expressed as mean ± SEM of three independent experiments. ETO-resistant cell lines are marked in red. Cell sensitivity to doxorubicin (ADR) was also examined (see ). ( B ) Heat map illustrating expression of BCL6 target genes in Capan-2, H661 and PC9 cell lines. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. mRNA was isolated from treated cells and sequenced. Z-scores were calculated based on counts of exon model per million mapped reads. BCL6 target genes were identified by a cutoff of P < 0.05, n = 3. ( C ) BCL6 mRNA expression in ETO-resistant and -sensitive cells. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. QPCR assays were subsequently performed. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ETO-resistant cell lines are marked in red. ( D ) Validation of differentially expressed target genes of BCL6 in Capan-2 and H661 cells using qPCR analysis. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ( E ) Normalized BCL6 mRNA expression levels in MCF7 and MCF7/ETO (required ETO-resistant MCF7), or A2780 and A2780/ADR (required ADR-resistant A2780). Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, *** P < 0.001, unpaired, two tailed t -test. ( F ) BCL6 protein expression levels in different cancer cell lines in response to various genotoxic agents. Cells were treated with indicated genotoxic agents for 24 h. BCL6 protein expression levels were detected and normalized to GAPDH expression using immunoblotting analysis. Representative images related to . The ratio of genotoxic agent-treated groups to the control group was calculated. CDDP, cisplatin; Carbo, carboplatin; GEM, gemcitabine. ( G ) Kaplan-Meier curves of ovarian cancer patients treated with cisplatin, taxol or both drugs. The curves were stratified by BCL6 (215990_s_at) expression. The following source data and figure supplements are available for : Figure 1-Source data 1. Genotoxic agents promote BCL6 expression. Figure 1-figure supplement 1. Genotoxic agents promote BCL6 expression.

Journal: bioRxiv

Article Title: The Oncoprotein BCL6 Enables Cancer Cells to Evade Genotoxic Stress

doi: 10.1101/2021.06.15.448559

Figure Lengend Snippet: Genotoxic agents promote BCL6 expression. ( A ) Cell sensitivity to etoposide (ETO). Cancer cells were treated with etoposide at gradient concentrations for 48 h. IC 50 s were measured using Sulforhodamine B (SRB) assays. Values are expressed as mean ± SEM of three independent experiments. ETO-resistant cell lines are marked in red. Cell sensitivity to doxorubicin (ADR) was also examined (see ). ( B ) Heat map illustrating expression of BCL6 target genes in Capan-2, H661 and PC9 cell lines. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. mRNA was isolated from treated cells and sequenced. Z-scores were calculated based on counts of exon model per million mapped reads. BCL6 target genes were identified by a cutoff of P < 0.05, n = 3. ( C ) BCL6 mRNA expression in ETO-resistant and -sensitive cells. Cells were treated with etoposide at their respective 1/2 IC 50 s for 24 h. QPCR assays were subsequently performed. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ETO-resistant cell lines are marked in red. ( D ) Validation of differentially expressed target genes of BCL6 in Capan-2 and H661 cells using qPCR analysis. Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, ** P < 0.01 and *** P < 0.001, unpaired, two tailed t -test. ( E ) Normalized BCL6 mRNA expression levels in MCF7 and MCF7/ETO (required ETO-resistant MCF7), or A2780 and A2780/ADR (required ADR-resistant A2780). Values are expressed as mean ± SEM of three independent experiments. * P < 0.05, *** P < 0.001, unpaired, two tailed t -test. ( F ) BCL6 protein expression levels in different cancer cell lines in response to various genotoxic agents. Cells were treated with indicated genotoxic agents for 24 h. BCL6 protein expression levels were detected and normalized to GAPDH expression using immunoblotting analysis. Representative images related to . The ratio of genotoxic agent-treated groups to the control group was calculated. CDDP, cisplatin; Carbo, carboplatin; GEM, gemcitabine. ( G ) Kaplan-Meier curves of ovarian cancer patients treated with cisplatin, taxol or both drugs. The curves were stratified by BCL6 (215990_s_at) expression. The following source data and figure supplements are available for : Figure 1-Source data 1. Genotoxic agents promote BCL6 expression. Figure 1-figure supplement 1. Genotoxic agents promote BCL6 expression.

Article Snippet: Etoposide (HY-13629, a topoisomerase II inhibitor), doxorubicin (HY-15142, a topoisomerase II inhibitor), cisplatin (HY-17394, a DNA synthesis inhibitor), carboplatin (HY-17393, a DNA synthesis inhibitor), taxol (HY-B0015, a microtubule association inhibitor) and gemcitabine (HY-17026, a DNA synthesis inhibitor) were purchased from MedChemExpress (Monmouth Junction, USA).

Techniques: Expressing, Isolation, Two Tailed Test, Biomarker Discovery, Western Blot, Control

Genotoxic agents promote BCL6 expression. ( A ) Cell sensitivity to doxorubicin (ADR). Various cancer cell lines were treated with ADR at gradient concentrations for 48 h. IC 50 s were measured using SRB assays. Values are expressed as mean ± SEM of three independent experiments with triplates. ADR-resistant cell lines are marked in red. ( B ) BCL6 protein expression levels in different cancer cell lines in response to genotoxic agents. Cells were treated with indicated genotoxic agents at their respective IC 50 s for 24 h. Proteins lysates from each cell line were blotted individually. CDDP, cisplatin; Carbo, carboplatin; ETO, etoposide; GEM, gemcitabine.

Journal: bioRxiv

Article Title: The Oncoprotein BCL6 Enables Cancer Cells to Evade Genotoxic Stress

doi: 10.1101/2021.06.15.448559

Figure Lengend Snippet: Genotoxic agents promote BCL6 expression. ( A ) Cell sensitivity to doxorubicin (ADR). Various cancer cell lines were treated with ADR at gradient concentrations for 48 h. IC 50 s were measured using SRB assays. Values are expressed as mean ± SEM of three independent experiments with triplates. ADR-resistant cell lines are marked in red. ( B ) BCL6 protein expression levels in different cancer cell lines in response to genotoxic agents. Cells were treated with indicated genotoxic agents at their respective IC 50 s for 24 h. Proteins lysates from each cell line were blotted individually. CDDP, cisplatin; Carbo, carboplatin; ETO, etoposide; GEM, gemcitabine.

Article Snippet: Etoposide (HY-13629, a topoisomerase II inhibitor), doxorubicin (HY-15142, a topoisomerase II inhibitor), cisplatin (HY-17394, a DNA synthesis inhibitor), carboplatin (HY-17393, a DNA synthesis inhibitor), taxol (HY-B0015, a microtubule association inhibitor) and gemcitabine (HY-17026, a DNA synthesis inhibitor) were purchased from MedChemExpress (Monmouth Junction, USA).

Techniques: Expressing

BCL6 transactivation is correlated with therapy resistance. ( A ) Association between BCL6 upregulation with ETO sensitivity in various cancer cell lines. Representative images related to . Left vertical axis, IC 50 s of etoposide in different cancer cell lines; right vertical axis, relative BCL6 protein levels compared with that of the control group; horizontal axis, cancer cell lines. ( B ) Correlation analysis. Correlation between BCL6 upregulation levels and ETO IC 50 s or ADR IC 50 s (see ). ( C ) Etoposide induced BCL6 protein expression in a time-dependent manner. ETO-resistant or -sensitive cells were treated with etoposide at their respective 1/4 IC 50 s for 2, 4 or 6 days. Cell lysates were collected and probed with specific antibodies using Western blotting assays. ETO-resistant cell lines are marked in red. ( D ) Etoposide increased BCL6 expression and decreased the phosphorylated levels of γ-H2AX (S139) in HCT116 xenografts treated with 10 mg/kg etoposide for 14 days. At the end of the experiment, tumor tissues were isolated and subjected to immunoblotting analysis. Six biologically independent samples of each group are shown. Tumor volume curves and tumor weight are shown in . ( E ) Relative clonogenic growth of ETO-resistant cells. HCT116 cells were transfected with BCL6 siRNAs or the control siRNA, followed by the treatment of 0.2 μM etoposide for 7 days. The expression of BCL6 was detected by immunoblotting analysis ( right ). Values are expressed as mean ± SEM of three independent experiments by setting the control group as 100%. *** P < 0.001, unpaired, two tailed t -test. ( F) Relative clonogenic growth of ETO-resistant cells. HCT116 cells stably transfected with shRNA targeting BCL6 were exposed to etoposide (0.2 or 0.4 μM) with or without doxycycline (Dox) for 7 days. The clonogenic growth were examined. The BCL6 expression levels were detected by an immunoblotting assay ( right ). Values are expressed as mean ± SEM. *** P < 0.001, unpaired, two tailed t -test. ( G ) BCL6 overexpression decreased the sensitivity of H522 cells to etoposide ( left ). ETO-sensitive H522 cells were transfected with pcDNA3.1-BCL6 or pcDNA3.1 control plasmid, and then treated with etoposide at gradient concentrations for 48 h. The etoposide IC 50 s were detected by SRB assays. BCL6 overexpression efficiency was examined by an immunoblotting assay ( right ). ( H ) Cell viability curves of required doxorubicin-resistant cells in response to BCL6 knockdown. MCF7/ADR cells were transfected with siRNAs targeting BCL6 or the control siRNA. Data are presented as mean ± SEM of six independent experiments by setting the control group as 1. *** P < 0.001, unpaired, two tailed t -test ( right ). The following source data and figure supplements are available for : Figure 2-Source data 1. BCL6 transactivation is correlated with therapy resistance. Figure 2-figure supplement 1. BCL6 upregulation is associated with therapy resistance.

Journal: bioRxiv

Article Title: The Oncoprotein BCL6 Enables Cancer Cells to Evade Genotoxic Stress

doi: 10.1101/2021.06.15.448559

Figure Lengend Snippet: BCL6 transactivation is correlated with therapy resistance. ( A ) Association between BCL6 upregulation with ETO sensitivity in various cancer cell lines. Representative images related to . Left vertical axis, IC 50 s of etoposide in different cancer cell lines; right vertical axis, relative BCL6 protein levels compared with that of the control group; horizontal axis, cancer cell lines. ( B ) Correlation analysis. Correlation between BCL6 upregulation levels and ETO IC 50 s or ADR IC 50 s (see ). ( C ) Etoposide induced BCL6 protein expression in a time-dependent manner. ETO-resistant or -sensitive cells were treated with etoposide at their respective 1/4 IC 50 s for 2, 4 or 6 days. Cell lysates were collected and probed with specific antibodies using Western blotting assays. ETO-resistant cell lines are marked in red. ( D ) Etoposide increased BCL6 expression and decreased the phosphorylated levels of γ-H2AX (S139) in HCT116 xenografts treated with 10 mg/kg etoposide for 14 days. At the end of the experiment, tumor tissues were isolated and subjected to immunoblotting analysis. Six biologically independent samples of each group are shown. Tumor volume curves and tumor weight are shown in . ( E ) Relative clonogenic growth of ETO-resistant cells. HCT116 cells were transfected with BCL6 siRNAs or the control siRNA, followed by the treatment of 0.2 μM etoposide for 7 days. The expression of BCL6 was detected by immunoblotting analysis ( right ). Values are expressed as mean ± SEM of three independent experiments by setting the control group as 100%. *** P < 0.001, unpaired, two tailed t -test. ( F) Relative clonogenic growth of ETO-resistant cells. HCT116 cells stably transfected with shRNA targeting BCL6 were exposed to etoposide (0.2 or 0.4 μM) with or without doxycycline (Dox) for 7 days. The clonogenic growth were examined. The BCL6 expression levels were detected by an immunoblotting assay ( right ). Values are expressed as mean ± SEM. *** P < 0.001, unpaired, two tailed t -test. ( G ) BCL6 overexpression decreased the sensitivity of H522 cells to etoposide ( left ). ETO-sensitive H522 cells were transfected with pcDNA3.1-BCL6 or pcDNA3.1 control plasmid, and then treated with etoposide at gradient concentrations for 48 h. The etoposide IC 50 s were detected by SRB assays. BCL6 overexpression efficiency was examined by an immunoblotting assay ( right ). ( H ) Cell viability curves of required doxorubicin-resistant cells in response to BCL6 knockdown. MCF7/ADR cells were transfected with siRNAs targeting BCL6 or the control siRNA. Data are presented as mean ± SEM of six independent experiments by setting the control group as 1. *** P < 0.001, unpaired, two tailed t -test ( right ). The following source data and figure supplements are available for : Figure 2-Source data 1. BCL6 transactivation is correlated with therapy resistance. Figure 2-figure supplement 1. BCL6 upregulation is associated with therapy resistance.

Article Snippet: Etoposide (HY-13629, a topoisomerase II inhibitor), doxorubicin (HY-15142, a topoisomerase II inhibitor), cisplatin (HY-17394, a DNA synthesis inhibitor), carboplatin (HY-17393, a DNA synthesis inhibitor), taxol (HY-B0015, a microtubule association inhibitor) and gemcitabine (HY-17026, a DNA synthesis inhibitor) were purchased from MedChemExpress (Monmouth Junction, USA).

Techniques: Control, Expressing, Western Blot, Isolation, Transfection, Two Tailed Test, Stable Transfection, shRNA, Over Expression, Plasmid Preparation, Knockdown

Therapeutic suppression of BCL6 sensitizes genotoxic agents. ( A ) Pharmacological inhibition of BCL6 increased ETO sensitivity. Various types of cancer cells were treated with etoposide at gradient concentrations for 48 h in the presence of 10 μM BI3802 or 20 μM Compound 7 ( n = 2 biological replicates). IC 50 s were measured using SRB assays. For graphs, log(IC 50 ) of control cells was subtracted from log(IC 50 ) of BI3802 or Compound 7-treated cells and multiplied by ten to be depicted as log fold change ×10. Targeted inhibition of BCL6 also increased ADR sensitivity (see ). ( B ) Synergistic interaction between BCL6 inhibitors (BI3802 or Compound 7) and ETO. Growth inhibition was averaged and input into CalcuSyn software to extrapolate combinational index values (CI) at 50% effective dose (ED50), 75% effective dose (ED75) and 90% effective dose (ED90). CI values < 1 represent synergism. The synergy between BI3802 and ADR was also detected in H838, Capan-2 and AsPC-1 cells (see ). ( C ) Inhibition of clonogenic growth by the combined regimen. Representative long-term clonogenic images ( up ) and quantified clonogenic growth inhibition results ( down ) for cells treated with ETO, BI3802, or their combinations. Data are presented as mean of three independent experiments. The same experiments were also conducted for ADR (see ). ( D ) Inhibition of soft-agar colony growth by the combined regimen. HCT116 cells were exposed to 0.2 μM etoposide, 2 μM BI3802, or their combinations. Representative images of soft-agar colonies ( left ) and the relative clonogenic growth ( right ) are shown. Scale bar, 100 μm. Values are expressed as the mean ± SEM of three independent experiments. *** P < 0.001, unpaired, two tailed t -test. ( E ) Immunoblotting analysis showing the protein expression of BCL6, p-γ-H2AX S139 and cleaved-PARP in Capan-2 and H661 cells treated with 15 μM etoposide, 10 μM BI3802 or their combinations for 48 h. Cell lysates were subjected to immunoblotting analysis. ( F ) Comet assays. HCT116 and Capan-2 cells were treated with etoposide, BI3802, or their combinations for 48 h. The tail moment was quantified for 50 cells for each experimental condition ( right ). Scale bar, 100 μm. Values are expressed as mean ± SEM. *** P < 0.001, unpaired, two tailed t -test. ( G ) Quantification of apoptotic cells in Capan-2 cells analyzed by flow cytometry. Cells were exposed to 15 μM etoposide, 10 μM BI3802 or their combinations for 48 h. Percentage of positive cells was counted. Values are expressed as mean ± SEM of three independent experiments. *** P < 0.001, unpaired, two tailed t -test. The following source data and figure supplements are available for : Figure 6-Source data 1. Therapeutic suppression of BCL6 sensitizes genotoxic agents. Figure 6-figure supplement 1. BCL6 inhibition sensitizes cancer cells to doxorubicin.

Journal: bioRxiv

Article Title: The Oncoprotein BCL6 Enables Cancer Cells to Evade Genotoxic Stress

doi: 10.1101/2021.06.15.448559

Figure Lengend Snippet: Therapeutic suppression of BCL6 sensitizes genotoxic agents. ( A ) Pharmacological inhibition of BCL6 increased ETO sensitivity. Various types of cancer cells were treated with etoposide at gradient concentrations for 48 h in the presence of 10 μM BI3802 or 20 μM Compound 7 ( n = 2 biological replicates). IC 50 s were measured using SRB assays. For graphs, log(IC 50 ) of control cells was subtracted from log(IC 50 ) of BI3802 or Compound 7-treated cells and multiplied by ten to be depicted as log fold change ×10. Targeted inhibition of BCL6 also increased ADR sensitivity (see ). ( B ) Synergistic interaction between BCL6 inhibitors (BI3802 or Compound 7) and ETO. Growth inhibition was averaged and input into CalcuSyn software to extrapolate combinational index values (CI) at 50% effective dose (ED50), 75% effective dose (ED75) and 90% effective dose (ED90). CI values < 1 represent synergism. The synergy between BI3802 and ADR was also detected in H838, Capan-2 and AsPC-1 cells (see ). ( C ) Inhibition of clonogenic growth by the combined regimen. Representative long-term clonogenic images ( up ) and quantified clonogenic growth inhibition results ( down ) for cells treated with ETO, BI3802, or their combinations. Data are presented as mean of three independent experiments. The same experiments were also conducted for ADR (see ). ( D ) Inhibition of soft-agar colony growth by the combined regimen. HCT116 cells were exposed to 0.2 μM etoposide, 2 μM BI3802, or their combinations. Representative images of soft-agar colonies ( left ) and the relative clonogenic growth ( right ) are shown. Scale bar, 100 μm. Values are expressed as the mean ± SEM of three independent experiments. *** P < 0.001, unpaired, two tailed t -test. ( E ) Immunoblotting analysis showing the protein expression of BCL6, p-γ-H2AX S139 and cleaved-PARP in Capan-2 and H661 cells treated with 15 μM etoposide, 10 μM BI3802 or their combinations for 48 h. Cell lysates were subjected to immunoblotting analysis. ( F ) Comet assays. HCT116 and Capan-2 cells were treated with etoposide, BI3802, or their combinations for 48 h. The tail moment was quantified for 50 cells for each experimental condition ( right ). Scale bar, 100 μm. Values are expressed as mean ± SEM. *** P < 0.001, unpaired, two tailed t -test. ( G ) Quantification of apoptotic cells in Capan-2 cells analyzed by flow cytometry. Cells were exposed to 15 μM etoposide, 10 μM BI3802 or their combinations for 48 h. Percentage of positive cells was counted. Values are expressed as mean ± SEM of three independent experiments. *** P < 0.001, unpaired, two tailed t -test. The following source data and figure supplements are available for : Figure 6-Source data 1. Therapeutic suppression of BCL6 sensitizes genotoxic agents. Figure 6-figure supplement 1. BCL6 inhibition sensitizes cancer cells to doxorubicin.

Article Snippet: Etoposide (HY-13629, a topoisomerase II inhibitor), doxorubicin (HY-15142, a topoisomerase II inhibitor), cisplatin (HY-17394, a DNA synthesis inhibitor), carboplatin (HY-17393, a DNA synthesis inhibitor), taxol (HY-B0015, a microtubule association inhibitor) and gemcitabine (HY-17026, a DNA synthesis inhibitor) were purchased from MedChemExpress (Monmouth Junction, USA).

Techniques: Inhibition, Control, Software, Two Tailed Test, Western Blot, Expressing, Flow Cytometry

BCL6 inhibition sensitizes cancer cells to doxorubicin. ( A ) Increased sensitivity of cancer cells to doxorubicin. ADR-resistant cancer cells were treated with doxorubicin at gradient concentrations for 48 h in the presence of 10 μM BI3802. IC 50 s were measured using SRB assays. Values are expressed as mean ± SEM of two independent experiments. ADR-resistant cell lines are marked in red. ( B ) Cell viability of ADR-resistant cancer cells treated with different concentrations of doxorubicin in the combination with BI3802. Growth inhibition for three independent biological replicate experiments was averaged and input into CalcuSyn software to extrapolate CI values. CI values < 1 represent synergism. Values are expressed as mean ± SEM of three independent experiments. ADR-resistant cell lines are marked in red. ( C ) Representative long-term clonogenic assays ( left ) and quantified clonogenic growth inhibition data ( right ) for H838 and OVCAR8 cells treated with ADR, BI3802, or their combinations. Data are presented as mean of three independent experiments.

Journal: bioRxiv

Article Title: The Oncoprotein BCL6 Enables Cancer Cells to Evade Genotoxic Stress

doi: 10.1101/2021.06.15.448559

Figure Lengend Snippet: BCL6 inhibition sensitizes cancer cells to doxorubicin. ( A ) Increased sensitivity of cancer cells to doxorubicin. ADR-resistant cancer cells were treated with doxorubicin at gradient concentrations for 48 h in the presence of 10 μM BI3802. IC 50 s were measured using SRB assays. Values are expressed as mean ± SEM of two independent experiments. ADR-resistant cell lines are marked in red. ( B ) Cell viability of ADR-resistant cancer cells treated with different concentrations of doxorubicin in the combination with BI3802. Growth inhibition for three independent biological replicate experiments was averaged and input into CalcuSyn software to extrapolate CI values. CI values < 1 represent synergism. Values are expressed as mean ± SEM of three independent experiments. ADR-resistant cell lines are marked in red. ( C ) Representative long-term clonogenic assays ( left ) and quantified clonogenic growth inhibition data ( right ) for H838 and OVCAR8 cells treated with ADR, BI3802, or their combinations. Data are presented as mean of three independent experiments.

Article Snippet: Etoposide (HY-13629, a topoisomerase II inhibitor), doxorubicin (HY-15142, a topoisomerase II inhibitor), cisplatin (HY-17394, a DNA synthesis inhibitor), carboplatin (HY-17393, a DNA synthesis inhibitor), taxol (HY-B0015, a microtubule association inhibitor) and gemcitabine (HY-17026, a DNA synthesis inhibitor) were purchased from MedChemExpress (Monmouth Junction, USA).

Techniques: Inhibition, Software

Generation and characterization of scR1antTNF-Fc protein. A, schematic structure modeling of scR1antTNF-Fc protein. Two TNFR1 antagonistic proteins were fused with human IgG-Fc. N, N-terminal. Amino acid sequences and domain information of scR1antTNF-Fc are described in Fig. S1A. B, X-ray structure modeling of the scR1antTNF-TNFR1 complex. scR1antTNF bound to the homotrimer of TNFR1. Red, TNFR1; green, TNFR1 interaction domain of scR1antTNF; orange, peptide linker for forming the single-chain structure. C, schematic pCAG-based mammalian expression vector for scR1antTNF-Fc protein. The cDNA was composed to express scR1antTNF-Fc whereby triple R1antTNF domains fused by peptide linkers (GGGSGGG) were further fused to a human–IgG Fc domain (Ch2 and Ch3). Signal sequence peptide genes derived from a mouse IgG Vh (Vhss) or human IL-2 (IL-2ss) were linked at the 5′-terminal of scR1antTNF-Fc cDNA. D, supernatants of cultured medium (left side) and purified proteins (right side) 7 days after transfection were assessed by SDS-PAGE following Coomassie Brilliant Blue staining. Arrowhead shows an ∼75-kDa band of the scR1antTNF-Fc monomer. E, each recombinant protein expressed with Vhss and IL-2ss was purified by size-exclusion chromatography. F, the molecular weight of monomeric scR1antTNF-Fc protein was confirmed by Western blotting with an anti-human IgG-Fc antibody.

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: Generation and characterization of scR1antTNF-Fc protein. A, schematic structure modeling of scR1antTNF-Fc protein. Two TNFR1 antagonistic proteins were fused with human IgG-Fc. N, N-terminal. Amino acid sequences and domain information of scR1antTNF-Fc are described in Fig. S1A. B, X-ray structure modeling of the scR1antTNF-TNFR1 complex. scR1antTNF bound to the homotrimer of TNFR1. Red, TNFR1; green, TNFR1 interaction domain of scR1antTNF; orange, peptide linker for forming the single-chain structure. C, schematic pCAG-based mammalian expression vector for scR1antTNF-Fc protein. The cDNA was composed to express scR1antTNF-Fc whereby triple R1antTNF domains fused by peptide linkers (GGGSGGG) were further fused to a human–IgG Fc domain (Ch2 and Ch3). Signal sequence peptide genes derived from a mouse IgG Vh (Vhss) or human IL-2 (IL-2ss) were linked at the 5′-terminal of scR1antTNF-Fc cDNA. D, supernatants of cultured medium (left side) and purified proteins (right side) 7 days after transfection were assessed by SDS-PAGE following Coomassie Brilliant Blue staining. Arrowhead shows an ∼75-kDa band of the scR1antTNF-Fc monomer. E, each recombinant protein expressed with Vhss and IL-2ss was purified by size-exclusion chromatography. F, the molecular weight of monomeric scR1antTNF-Fc protein was confirmed by Western blotting with an anti-human IgG-Fc antibody.

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Expressing, Plasmid Preparation, Sequencing, Derivative Assay, Cell Culture, Purification, Transfection, SDS Page, Staining, Recombinant, Size-exclusion Chromatography, Molecular Weight, Western Blot

In vitro binding affinity of scR1antTNF-Fc. A, in vitro receptor-binding ability of human TNFα, scR1antTNF, and scR1antTNF-Fcs to human TNFR1 and human TNFR2 was analyzed by SPR. Each sensorgram shows the association (120 s) and dissociation (120 s) repeats at five serial concentrations (1.2, 3.7, 11.1, 33.3, and 100 nm) using single-cycle kinetics. Analytes: TNFα, scR1antTNF, scR1antTNF-Fc (Vhss), and scR1antTNF-Fc (IL-2ss). Ligands: Fc chimera proteins of human TNFR1 and human TNFR2. B, kinetic parameters of each protein to human TNFR1/TNFR2 were analyzed with a 1:1 binding model using BIAcore × 100 evaluation software (n = 1). The avidity of scR1antTNF-Fc (Vhss) and scR1antTNF-Fc (IL-2ss) were analyzed as a bivalent analyte. Kd, ka, and kd indicated the dissociation constant, association rate constant, and dissociation rate constant, respectively.

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: In vitro binding affinity of scR1antTNF-Fc. A, in vitro receptor-binding ability of human TNFα, scR1antTNF, and scR1antTNF-Fcs to human TNFR1 and human TNFR2 was analyzed by SPR. Each sensorgram shows the association (120 s) and dissociation (120 s) repeats at five serial concentrations (1.2, 3.7, 11.1, 33.3, and 100 nm) using single-cycle kinetics. Analytes: TNFα, scR1antTNF, scR1antTNF-Fc (Vhss), and scR1antTNF-Fc (IL-2ss). Ligands: Fc chimera proteins of human TNFR1 and human TNFR2. B, kinetic parameters of each protein to human TNFR1/TNFR2 were analyzed with a 1:1 binding model using BIAcore × 100 evaluation software (n = 1). The avidity of scR1antTNF-Fc (Vhss) and scR1antTNF-Fc (IL-2ss) were analyzed as a bivalent analyte. Kd, ka, and kd indicated the dissociation constant, association rate constant, and dissociation rate constant, respectively.

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: In Vitro, Binding Assay, Software

Thermal stability of scR1antTNF-Fc. A, thermal stabilities of scR1antTNF, scR1antTNF-Fc (Vhss), scR1antTNF-Fc (IL-2ss) and etanercept were measured by thermal shift assay using differential scanning fluorometry. Proteins serially diluted from 250 μg/ml by 2-fold dilution are indicated. B, temperature of the peak apex of five concentrations show the denaturation temperature (Tm). Tm values calculated from the result of thermal shift assay using Protein Thermal Shift Software.

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: Thermal stability of scR1antTNF-Fc. A, thermal stabilities of scR1antTNF, scR1antTNF-Fc (Vhss), scR1antTNF-Fc (IL-2ss) and etanercept were measured by thermal shift assay using differential scanning fluorometry. Proteins serially diluted from 250 μg/ml by 2-fold dilution are indicated. B, temperature of the peak apex of five concentrations show the denaturation temperature (Tm). Tm values calculated from the result of thermal shift assay using Protein Thermal Shift Software.

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Thermal Shift Assay, Software

In vitro bioactivity of scR1antTNF-Fc via TNFR1 or TNFR2. A, in vitro agonistic bioactivities of scR1antTNF or scR1antTNF-Fcs through TNFR1 for LM cells were measured. Human TNFα was used as a control. B, antagonistic activities of scR1antTNF, scR1antTNF-Fc (Vhss), and scR1antTNF-Fc (IL-2ss) via TNFR1 were confirmed by LM cell assay. LM cells were treated with each protein in the presence of mouse TNFα (5 ng/ml). The TNF inhibition rate was determined from the LM cell viability. C, NF-κB induction was evaluated by reporter assay using Ramos-Blue cells. Ligand-dependent SEAP activities were detected. D, agonistic activity via TNFR2 was evaluated by the cell death of huTNFR2/mFas preadipocytes. Data are shown as the mean ± S.D. (n = 3).

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: In vitro bioactivity of scR1antTNF-Fc via TNFR1 or TNFR2. A, in vitro agonistic bioactivities of scR1antTNF or scR1antTNF-Fcs through TNFR1 for LM cells were measured. Human TNFα was used as a control. B, antagonistic activities of scR1antTNF, scR1antTNF-Fc (Vhss), and scR1antTNF-Fc (IL-2ss) via TNFR1 were confirmed by LM cell assay. LM cells were treated with each protein in the presence of mouse TNFα (5 ng/ml). The TNF inhibition rate was determined from the LM cell viability. C, NF-κB induction was evaluated by reporter assay using Ramos-Blue cells. Ligand-dependent SEAP activities were detected. D, agonistic activity via TNFR2 was evaluated by the cell death of huTNFR2/mFas preadipocytes. Data are shown as the mean ± S.D. (n = 3).

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: In Vitro, Control, Inhibition, Reporter Assay, Activity Assay

In vivo plasma clearance of scR1antTNF-Fc. A, plasma clearances of scR1antTNF, scR1antTNF-Fc, and etanercept were confirmed after i.p. injection. Etanercept was used as a positive control. Plasma concentrations of these proteins were measured by ELISA for human TNF or human IgG-Fc. Data are shown as the mean ± S.D. of five mice per group. B, half-lives and AUCs were calculated from time-concentration curves by moment analysis.

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: In vivo plasma clearance of scR1antTNF-Fc. A, plasma clearances of scR1antTNF, scR1antTNF-Fc, and etanercept were confirmed after i.p. injection. Etanercept was used as a positive control. Plasma concentrations of these proteins were measured by ELISA for human TNF or human IgG-Fc. Data are shown as the mean ± S.D. of five mice per group. B, half-lives and AUCs were calculated from time-concentration curves by moment analysis.

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: In Vivo, Injection, Positive Control, Enzyme-linked Immunosorbent Assay, Concentration Assay

scR1antTNF-Fc treatment suppresses inflammation in arthritis mice. A, DBA/1 mice were immunized by the subcutaneous injection of bovine type II collagen with CFA. Saline (n = 6), etanercept (1250 μg/kg) (n = 6), and scR1antTNF-Fc (50 μg/kg) (n = 6) were administered i.p. twice a week from day 22 after immunization. B and C, sum of arthritis scores of four paws (B) and body weight (C) were measured for 3 weeks. D, arthritis incidence was calculated from the number of mice with swollen limbs. E, joint swelling in a representative individual from each group at day 42 is shown. Data are shown as the mean ± S.E.; *p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test).

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: scR1antTNF-Fc treatment suppresses inflammation in arthritis mice. A, DBA/1 mice were immunized by the subcutaneous injection of bovine type II collagen with CFA. Saline (n = 6), etanercept (1250 μg/kg) (n = 6), and scR1antTNF-Fc (50 μg/kg) (n = 6) were administered i.p. twice a week from day 22 after immunization. B and C, sum of arthritis scores of four paws (B) and body weight (C) were measured for 3 weeks. D, arthritis incidence was calculated from the number of mice with swollen limbs. E, joint swelling in a representative individual from each group at day 42 is shown. Data are shown as the mean ± S.E.; *p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test).

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Injection, Saline

Effects of scR1antTNF-Fc treatment on joint pathology and blood cytokine levels. A, after treatment of CIA mice with saline, etanercept (1250 μg/kg), or scR1antTNF-Fc (50 μg/kg) for 3 weeks (on day 42), histological sections of the ankle joint from a hind limb were prepared and stained with H&E. B, histopathologic features such as cell infiltration, synovitis, destruction of cartilage, and the juxta-articular bone involvement on day 42 were scored. C, TRAP-positive cells were stained using serial sections to detect osteoclasts. TRAP-positive cells with ≥1 nucleus were counted as indicated by an arrow. D, mouse IL-1β (n = 6) in plasma on day 42 was measured by ELISA. Etanercept, 1250 μg/kg; scR1antTNF-Fc, 50 μg/kg. Data are shown as the mean ± S.D.; *, p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test).

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: Effects of scR1antTNF-Fc treatment on joint pathology and blood cytokine levels. A, after treatment of CIA mice with saline, etanercept (1250 μg/kg), or scR1antTNF-Fc (50 μg/kg) for 3 weeks (on day 42), histological sections of the ankle joint from a hind limb were prepared and stained with H&E. B, histopathologic features such as cell infiltration, synovitis, destruction of cartilage, and the juxta-articular bone involvement on day 42 were scored. C, TRAP-positive cells were stained using serial sections to detect osteoclasts. TRAP-positive cells with ≥1 nucleus were counted as indicated by an arrow. D, mouse IL-1β (n = 6) in plasma on day 42 was measured by ELISA. Etanercept, 1250 μg/kg; scR1antTNF-Fc, 50 μg/kg. Data are shown as the mean ± S.D.; *, p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test).

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Saline, Staining, Enzyme-linked Immunosorbent Assay

Effect of scR1antTNF-Fc administration on T cell subpopulations. At day 42, lymph nodes were isolated from CIA mice administered i.p. with saline (n = 6), etanercept (1250 μg/kg) (n = 6), or scR1antTNF-Fc (50 μg/kg) (n = 6) for 3 weeks. After single cells were prepared, the expressions of lymphocyte markers were analyzed by flow cytometry. A, representative flow cytometry data of each administration group are shown. T cells were separated by CD8, CD4, and Foxp3 expression levels. B, the percentage of CD4+ T cells and CD8+ T cells in lymph node cells was analyzed. C, the percentage of CD4+ Foxp3+ Tregs and CD4+ Foxp3− Tconvs in CD4+ T cells was measured. The ratio of Tregs/Tconvs was calculated from the results of individual mice. Data are shown as the mean ± S.D. of eight mice per group; *, p < 0.05, **, p < 0.01 (one-way ANOVA with Tukey's multiple comparisons test).

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: Effect of scR1antTNF-Fc administration on T cell subpopulations. At day 42, lymph nodes were isolated from CIA mice administered i.p. with saline (n = 6), etanercept (1250 μg/kg) (n = 6), or scR1antTNF-Fc (50 μg/kg) (n = 6) for 3 weeks. After single cells were prepared, the expressions of lymphocyte markers were analyzed by flow cytometry. A, representative flow cytometry data of each administration group are shown. T cells were separated by CD8, CD4, and Foxp3 expression levels. B, the percentage of CD4+ T cells and CD8+ T cells in lymph node cells was analyzed. C, the percentage of CD4+ Foxp3+ Tregs and CD4+ Foxp3− Tconvs in CD4+ T cells was measured. The ratio of Tregs/Tconvs was calculated from the results of individual mice. Data are shown as the mean ± S.D. of eight mice per group; *, p < 0.05, **, p < 0.01 (one-way ANOVA with Tukey's multiple comparisons test).

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Isolation, Saline, Flow Cytometry, Expressing

PEGylated scR1antTNF suppresses arthritis in CIA mice as well as scR1antTNF-Fc. A, schematic structure modeling of 40-kDa PEG-scR1antTNF. Branched PEG, which has two 20-kDa PEG chains, was fused to scR1anTNF on an N-terminal amine group. Amino acid sequences, domain information, and molecular modification sites of 40-kDa PEG-scR1antTNF are described in Fig. S1B. B, saline (n = 8), etanercept (1250 μg/kg) (n = 8), scR1antTNF-Fc (10 μg/kg) (n = 8), and 40-kDa PEG-scR1antTNF (10 μg/kg) (n = 8) were administered i.p. twice a week to CIA mice from day 22 after immunization. Arthritis scores were evaluated for 3 weeks. Data are shown as the mean ± S.E.; *, p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test). C, body weight was measured from day 22 to day 35. D, wrist joint swelling of a representative mouse in each group at day 35 is shown. E, the percentages of CD4+ T cells and CD8+ T cells in lymph node cells were analyzed in each treatment group on day 35 by FCM. F, the percentages of CD4+ Foxp3+ Tregs and CD4+ Foxp3− Tconvs in CD4+ T cells were analyzed at day 35. The ratio of Tregs/Tconvs was calculated from the results of individual mice. Data are shown as the mean ± S.D.; *, p < 0.05; **, p < 0.01 (one-way ANOVA with Tukey's multiple comparisons test).

Journal: The Journal of Biological Chemistry

Article Title: Structural optimization of a TNFR1-selective antagonistic TNFα mutant to create new-modality TNF-regulating biologics

doi: 10.1074/jbc.RA120.012723

Figure Lengend Snippet: PEGylated scR1antTNF suppresses arthritis in CIA mice as well as scR1antTNF-Fc. A, schematic structure modeling of 40-kDa PEG-scR1antTNF. Branched PEG, which has two 20-kDa PEG chains, was fused to scR1anTNF on an N-terminal amine group. Amino acid sequences, domain information, and molecular modification sites of 40-kDa PEG-scR1antTNF are described in Fig. S1B. B, saline (n = 8), etanercept (1250 μg/kg) (n = 8), scR1antTNF-Fc (10 μg/kg) (n = 8), and 40-kDa PEG-scR1antTNF (10 μg/kg) (n = 8) were administered i.p. twice a week to CIA mice from day 22 after immunization. Arthritis scores were evaluated for 3 weeks. Data are shown as the mean ± S.E.; *, p < 0.05 (one-way ANOVA with Tukey's multiple comparisons test). C, body weight was measured from day 22 to day 35. D, wrist joint swelling of a representative mouse in each group at day 35 is shown. E, the percentages of CD4+ T cells and CD8+ T cells in lymph node cells were analyzed in each treatment group on day 35 by FCM. F, the percentages of CD4+ Foxp3+ Tregs and CD4+ Foxp3− Tconvs in CD4+ T cells were analyzed at day 35. The ratio of Tregs/Tconvs was calculated from the results of individual mice. Data are shown as the mean ± S.D.; *, p < 0.05; **, p < 0.01 (one-way ANOVA with Tukey's multiple comparisons test).

Article Snippet: Induction of arthritis and administration of scR1antTNF-Fc A mixture of bovine collagen type II (2 mg/ml, Chondrex, Redmond, WA, USA) and complete Freund's adjuvant (CFA, 3 mg/ml, Chondrex) were prepared according to a standard collagen-induced arthritis protocol by Chondrex, Inc. Then, 100 μl of the emulsion was subcutaneously immunized in DBA/1 mice (male, 6 weeks old) at the base of the tail. scR1antTNF-Fc, 40-kDa PEG-scR1antTNF, etanercept (positive control) and saline (negative control) were administered i.p. twice a week from day 22 after immunization.

Techniques: Modification, Saline

Effects of l -cysteine on methylglyoxal (MGO)-induced cell toxicity in MES13 cells. ( A ) Chemical structure of ( a ); l -cysteine, ( b ); N -Acetyl- l -cysteine (NAC), ( c ); Cystine. ( B ) Cell viability of MES13 cells treated with MGO (500 μM) and equal concentrations (1.0 mM) of l -cysteine, NAC, and cystine. ( C ) Cell viability of MES13 cells treated with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( D ) Representative photographs of l -cysteine pre-treatment protection against MGO-induced cytotoxicity. Scale bar indicates 500 μm. ( E ) Quantitative measurements of confluence were evaluated using IncuCyte Zoom imaging system. ( F ) MGO-induced LDH production was evaluated by LDH assay in MES13 cells. All data are presented as mean ± SEM. n = 3 (### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on methylglyoxal (MGO)-induced cell toxicity in MES13 cells. ( A ) Chemical structure of ( a ); l -cysteine, ( b ); N -Acetyl- l -cysteine (NAC), ( c ); Cystine. ( B ) Cell viability of MES13 cells treated with MGO (500 μM) and equal concentrations (1.0 mM) of l -cysteine, NAC, and cystine. ( C ) Cell viability of MES13 cells treated with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( D ) Representative photographs of l -cysteine pre-treatment protection against MGO-induced cytotoxicity. Scale bar indicates 500 μm. ( E ) Quantitative measurements of confluence were evaluated using IncuCyte Zoom imaging system. ( F ) MGO-induced LDH production was evaluated by LDH assay in MES13 cells. All data are presented as mean ± SEM. n = 3 (### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: MTT Assay, Imaging, Lactate Dehydrogenase Assay, Control

Effects of l -cysteine on MGO-induced apoptosis and reactive oxygen species (ROS) generation in MES13 cells. ( A ) Representative cytograms of Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) staining of MGO-induced MES13 cells. Cells were pretreated with several concentrations l -cysteine for 1 h, then incubated with MGO (500 μM) for 24 h. After 24 h, the concentrations of viable (Annexin V-FITC and PI negative cells), early-stage apoptotic (Annexin V-FITC positive, PI negative cells), late-stage apoptotic (Annexin V-FITC positive, PI-positive cells), and necrotic (PI-positive cells) cells were analyzed by flow cytometry. ( a ) control; ( b ) 500 μM MGO; ( c ) MGO+ l -cysteine (0.1 mM); ( d ) MGO+ l -cysteine (0.5 mM); ( e ) MGO+ l -cysteine (1.0 mM); ( f ) MGO+AG (1.0 mM) as a positive control. ( B,C ) Quantitative data of representative cytograms of Annexin V-FITC and PI staining. Percentage of control (LL), early-stage apoptotic (LR), late-stage apoptotic (UR), and necrotic cells (UL) as analyzed using BD CellQuest Pro software. ( D ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. Green fluorescence (ROS generation) from 2′,7′-Dichlorofluorescin diacetate (DCF-DA) was examined by JuLI live-cell imaging system. Scale bar indicates 500 μm. ( E ) Quantitative measurements of fluorescent intensity were evaluated using Image J software. All data are presented as mean ± SEM. n = 3 (## p < 0.01, ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on MGO-induced apoptosis and reactive oxygen species (ROS) generation in MES13 cells. ( A ) Representative cytograms of Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) staining of MGO-induced MES13 cells. Cells were pretreated with several concentrations l -cysteine for 1 h, then incubated with MGO (500 μM) for 24 h. After 24 h, the concentrations of viable (Annexin V-FITC and PI negative cells), early-stage apoptotic (Annexin V-FITC positive, PI negative cells), late-stage apoptotic (Annexin V-FITC positive, PI-positive cells), and necrotic (PI-positive cells) cells were analyzed by flow cytometry. ( a ) control; ( b ) 500 μM MGO; ( c ) MGO+ l -cysteine (0.1 mM); ( d ) MGO+ l -cysteine (0.5 mM); ( e ) MGO+ l -cysteine (1.0 mM); ( f ) MGO+AG (1.0 mM) as a positive control. ( B,C ) Quantitative data of representative cytograms of Annexin V-FITC and PI staining. Percentage of control (LL), early-stage apoptotic (LR), late-stage apoptotic (UR), and necrotic cells (UL) as analyzed using BD CellQuest Pro software. ( D ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. Green fluorescence (ROS generation) from 2′,7′-Dichlorofluorescin diacetate (DCF-DA) was examined by JuLI live-cell imaging system. Scale bar indicates 500 μm. ( E ) Quantitative measurements of fluorescent intensity were evaluated using Image J software. All data are presented as mean ± SEM. n = 3 (## p < 0.01, ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Staining, Incubation, Flow Cytometry, Control, Positive Control, Software, Fluorescence, Live Cell Imaging

Effects of l -cysteine on apoptosis-related proteins and mitogen-activated protein kinase (MAPK) signaling pathway in MES13 cells. Cells were pretreated with l -cysteine for 1 h, followed by incubation with 500 μM MGO for 24 h. ( A ) The protein expression levels of Bax, Bcl-2, Caspase-3, and PARP were measured using western blot. ( B – D ) Bax/Bcl-2 ratio, Caspase-3, and PARP band intensity; α-tubulin was used as an internal control. ( E ) MES13 cells were pretreated with l -cysteine for 1 h, then incubated with 500 μM MGO for 1 h. The protein expression levels of MAPKs (extracellular signal-regulated kinase; ERK, c-Jun N terminal kinase; JNK, p38, and phosphorylated form) were examined by western blot. ( F – H ) p-ERK/ERK, p-JNK/JNK, and p-p38/p38 ratio and intensity; α-tubulin was used as an internal control. All data are presented as mean ± SEM. n = 3 (## p < 0.01, ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on apoptosis-related proteins and mitogen-activated protein kinase (MAPK) signaling pathway in MES13 cells. Cells were pretreated with l -cysteine for 1 h, followed by incubation with 500 μM MGO for 24 h. ( A ) The protein expression levels of Bax, Bcl-2, Caspase-3, and PARP were measured using western blot. ( B – D ) Bax/Bcl-2 ratio, Caspase-3, and PARP band intensity; α-tubulin was used as an internal control. ( E ) MES13 cells were pretreated with l -cysteine for 1 h, then incubated with 500 μM MGO for 1 h. The protein expression levels of MAPKs (extracellular signal-regulated kinase; ERK, c-Jun N terminal kinase; JNK, p38, and phosphorylated form) were examined by western blot. ( F – H ) p-ERK/ERK, p-JNK/JNK, and p-p38/p38 ratio and intensity; α-tubulin was used as an internal control. All data are presented as mean ± SEM. n = 3 (## p < 0.01, ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Incubation, Expressing, Western Blot, Control

Effects of l -cysteine on glyoxalase system-related protein and D-lactate production in MGO-induced MES13. Cells were pretreated with l -cysteine (0.1, 0.5, and 1.0 mM) for 1 h, followed by incubation with 500 μM MGO for 24 h. ( A ) The protein expression levels of Sirt1 and GLO-I were evaluated by western blot. ( B , C ) Sirt1 and GLO-I band intensity; α-tubulin was used as an internal control. ( D ) Quantitative levels of D-lactate were shown in MES13 cells. All data are presented as mean ± SEM. n = 3 (# p < 0.05, ## p < 0.01, ### p < 0.001 vs. Control, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on glyoxalase system-related protein and D-lactate production in MGO-induced MES13. Cells were pretreated with l -cysteine (0.1, 0.5, and 1.0 mM) for 1 h, followed by incubation with 500 μM MGO for 24 h. ( A ) The protein expression levels of Sirt1 and GLO-I were evaluated by western blot. ( B , C ) Sirt1 and GLO-I band intensity; α-tubulin was used as an internal control. ( D ) Quantitative levels of D-lactate were shown in MES13 cells. All data are presented as mean ± SEM. n = 3 (# p < 0.05, ## p < 0.01, ### p < 0.001 vs. Control, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Incubation, Expressing, Western Blot, Control

Effects of l -cysteine on MGO-induced cell toxicity and ROS generation in HEK 293 cells. ( A ) Cell viability of HEK 293 cells with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( B ) MGO-induced LDH production was evaluated by LDH assay in HEK 293 cells. ( C ) Representative cytograms of Annexin V-FITC and PI staining of MGO-induced HEK 293 cells. Cells were pre-treated with several concentrations l -cysteine for 1 h, then incubated with MGO (500 μM) for 24 h. After 24 h, the concentrations of viable (Annexin V-FITC and PI negative cells), early-stage apoptotic (Annexin V-FITC positive, PI negative cells), late-stage apoptotic (Annexin V-FITC positive, PI-positive cells), and necrotic (PI-positive cells) cells were analyzed by flow cytometry. ( a ) control; ( b ) 500 μM MGO; ( c ) MGO+ l -cysteine (0.1 mM); ( d ) MGO+ l -cysteine (0.5 mM); ( e ) MGO+ l -cysteine (1.0 mM); ( f ) MGO+AG (1.0 mM) as a positive control. ( D , E ) Percentage of control, early-stage apoptotic, late-stage apoptotic, and necrotic cells as analyzed by flow cytometry. ( F ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. Green fluorescence (ROS generation) from DCF-DA was examined by FAC analysis. Quantitative measurements of fluorescent intensity were evaluated using an FAC analysis system. ( a ) control vs 500 μM MGO; ( b ) 500 μM MGO+ l -cysteine (0.1 mM); ( c ) MGO+ l -cysteine (0.5 mM); ( d ) MGO+ l -cysteine (1.0 mM); ( e ) MGO+ AG (1.0 mM) as a positive control. All data are presented as mean ± SEM. n = 3 ( ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on MGO-induced cell toxicity and ROS generation in HEK 293 cells. ( A ) Cell viability of HEK 293 cells with MGO (500 μM) and various concentrations of l -cysteine (0.1, 0.5, and 1.0 mM) and analyzed using the MTT assay. ( B ) MGO-induced LDH production was evaluated by LDH assay in HEK 293 cells. ( C ) Representative cytograms of Annexin V-FITC and PI staining of MGO-induced HEK 293 cells. Cells were pre-treated with several concentrations l -cysteine for 1 h, then incubated with MGO (500 μM) for 24 h. After 24 h, the concentrations of viable (Annexin V-FITC and PI negative cells), early-stage apoptotic (Annexin V-FITC positive, PI negative cells), late-stage apoptotic (Annexin V-FITC positive, PI-positive cells), and necrotic (PI-positive cells) cells were analyzed by flow cytometry. ( a ) control; ( b ) 500 μM MGO; ( c ) MGO+ l -cysteine (0.1 mM); ( d ) MGO+ l -cysteine (0.5 mM); ( e ) MGO+ l -cysteine (1.0 mM); ( f ) MGO+AG (1.0 mM) as a positive control. ( D , E ) Percentage of control, early-stage apoptotic, late-stage apoptotic, and necrotic cells as analyzed by flow cytometry. ( F ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. Green fluorescence (ROS generation) from DCF-DA was examined by FAC analysis. Quantitative measurements of fluorescent intensity were evaluated using an FAC analysis system. ( a ) control vs 500 μM MGO; ( b ) 500 μM MGO+ l -cysteine (0.1 mM); ( c ) MGO+ l -cysteine (0.5 mM); ( d ) MGO+ l -cysteine (1.0 mM); ( e ) MGO+ AG (1.0 mM) as a positive control. All data are presented as mean ± SEM. n = 3 ( ### p < 0.001 vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: MTT Assay, Lactate Dehydrogenase Assay, Staining, Incubation, Flow Cytometry, Control, Positive Control, Fluorescence

Effects of l -cysteine on MGO-induced cytoskeletal proteins in MES13 cells. ( A ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. The cells were stained with Hoechst 33342 (blue) and F-actin (Red) Alexa Fluor 555 ® Phalloidin, and observed using confocal microscopy. The blue color indicated DAPI (nuclear) staining. Scale bar indicates 100 μm. ( B ) Quantitative measurements of F-actin fluorescence intensity were evaluated using NIS-Elements imaging software. Scale bar indicates 10 μm. All data are presented as mean ± SEM. n = 3 ( ## p < 0.01 vs. Control, *** p < 0.001 vs. MGO 500 μM).

Journal: Cells

Article Title: Effect of Cysteine on Methylglyoxal-Induced Renal Damage in Mesangial Cells

doi: 10.3390/cells9010234

Figure Lengend Snippet: Effects of l -cysteine on MGO-induced cytoskeletal proteins in MES13 cells. ( A ) MES13 cells were pretreated with l -cysteine for 1 h, followed by 500 μM MGO for 1 h. The cells were stained with Hoechst 33342 (blue) and F-actin (Red) Alexa Fluor 555 ® Phalloidin, and observed using confocal microscopy. The blue color indicated DAPI (nuclear) staining. Scale bar indicates 100 μm. ( B ) Quantitative measurements of F-actin fluorescence intensity were evaluated using NIS-Elements imaging software. Scale bar indicates 10 μm. All data are presented as mean ± SEM. n = 3 ( ## p < 0.01 vs. Control, *** p < 0.001 vs. MGO 500 μM).

Article Snippet: SV 40 MES13 (murine mesangial) and HEK 293 (human embryonic kidney) cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Staining, Confocal Microscopy, Fluorescence, Imaging, Software, Control

Figure 5. FAP localizes at invadopodia in various human cancer cells (A–C) (A) BxPC3 and SCC61 cells were seeded onto gelatin-coated coverslips for 48 h and labeled for FAP (green), F-actin (red), and cortactin (blue). Confocal image of SCC61 (B) and BxPC3 (C). Traces 1 and 2 are z axis sectioning of invadopodia in each cell line; associated graphs represent pixel intensities along the dotted lines to show the colocalization of FAP, F-actin, and cortactin. Scale bar, 10 mm. See also Figure S4.

Journal: Cell reports

Article Title: Fibroblast activation protein drives tumor metastasis via a protease-independent role in invadopodia stabilization.

doi: 10.1016/j.celrep.2023.113302

Figure Lengend Snippet: Figure 5. FAP localizes at invadopodia in various human cancer cells (A–C) (A) BxPC3 and SCC61 cells were seeded onto gelatin-coated coverslips for 48 h and labeled for FAP (green), F-actin (red), and cortactin (blue). Confocal image of SCC61 (B) and BxPC3 (C). Traces 1 and 2 are z axis sectioning of invadopodia in each cell line; associated graphs represent pixel intensities along the dotted lines to show the colocalization of FAP, F-actin, and cortactin. Scale bar, 10 mm. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: HMLER cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A Human: HMLE-Twist-ER cells Provided by Dr. Robert Weinberg (Mani et al.)28 N/A Human: SUM1315 cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A Human: MDA-MB-231 cells ATCC CRM-HTB-26 Human: SCC61 cells Provided by Dr. Alissa Weaver (Clark et al.)40 N/A Human: BxPC3 ATCC CRL-1687 Experimental Models: Organisms/Strains Nu/J mice UC San Diego ACP Strain: Nude/nude Oligonucleotides See Table S1 for primers used in this study Eton Bioscience N/A DPP4 shRNA#1: GGTCACCAGTGGGTCATAAAT Sigma-Aldrich TRCN0000372047 DPP4 shRNA#3: GCTGTGAATCCAACTGTAAAG N/A N/A Recombinant DNA pLKO.1 control shRNA Provided by Dr. David Root (Moffat et al.)64 Addgene plasmid #10879 pLKO.1 FAP shRNA #3 Sigma-Aldrich TRCN0000006805 pLKO.1 FAP shRNA #4 Sigma-Aldrich TRCN0000006806 pLKO.1 FAP shRNA #5 Sigma-Aldrich TRCN0000355737 pLKO.1 MT1-MMP shRNA #1 Sigma-Aldrich TRCN0000050853 pLKO.1 MT1-MMP shRNA #3 Sigma-Aldrich TRCN0000050855 pECFP-FAP-C1 plasmid Provided by Dr. Mark Gorrell (Wanget al)56 N/A MT1-MMP-pHluorin plasmid Provided by Dr. Philippe Chavrier (Lizárraga et al.)48 N/A pENTR-20 MT1-MMP-pHuji Provided by Dr. Camilla Raiborg (Pedersen et al.)49 N/A pWZL-Blast FAP S624A this manuscript Addgene Cat#207402 pWZL-Blast FAP A657S this manuscript Addgene Cat#207403 LifeAct-EGFP plasmid Provided by Dr. Keith Mostov N/A pRRL EGFP Gift from Dr. Robert Weinberg (Eckert et al.)20 N/A pWZL-Blast SRC Y530F Provided by Dr. Sara Courtneidge7 N/A Software and Algorithms GraphPad Prism 8 GraphPad https://www.graphpad.com/; RRID:SCR_002798 ImageJ NIH https://ImageJ.nih.gov/ij/; RRID:SCR_003070 cBioPortal MSK https://www.cbioportal.org/ NIS-Elements AR Version 5.30.04 Nikon Instruments inc. https://www.nikonusa.com

Techniques: Labeling